2School of Basic Medicine and Clinical Pharmacy, China Pharmaceutical University, Nanjing, China
3Department of Pharmacology, Nanjing Medical University, Nanjing, China
Corresponding author: Chen Qiao School of Basic Medicine and Clinical Pharmacy, China Pharmaceutical University, No. 639 Longmian Road, Jiangning District, Nanjing, Jiangsu, China E-mail: 279201754@qq.com
• Received: January 11, 2024 • Accepted: April 16, 2024
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Diabetic nephropathy (DN) is the most common and serious complication of diabetes mellitus. Shionone (SH), an important triterpenoid compound in the root extract of Aster, might exert a protective effect in DN mice and high glucose cultivated glomerular podocytes. The current study aimed to unravel the underlying mechanism by which SH mitigates DN. We postulate that SH stimulates the expression of sestrin-2 (SESN2), a pivotal stress-inducible protein in the anti-inflammasome machinery.
Methods
We utilized high-fat diet combined with streptozotocin (55 mg/kg intraperitoneal) for DN mice model, and high glucose (30 mM, 48 hours) cultured glomerular podocytes for DN cell model to evaluate the effect of SH. We also preformed experimentation on SESN2 deficiency models (SESN2 knockout mice and SESN2 siRNA in cells) to further prove our hypothesis.
Results
The results demonstrated that SH effectively suppressed glomerular fibrosis, induced adenosine monophosphate-activated protein kinase (AMPK) phosphorylation, and inhibited NLR family pyrin domain containing 3 (NLRP3) activation. Furthermore, our findings revealed that SH exerted its anti-inflammatory effect through Sesn2-dependent nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation and subsequent activation of its downstream target heme oxygenase-1 (HO-1).
Conclusion
In summary, our findings suggest that SH serves as a promising therapeutic agent for the treatment of DN-related glomerular fibrosis. SH enhances the expression of SESN2, attenuates α-smooth muscle actin accumulation, and suppresses NLRP3-related inflammation through the Nrf2/HO-1 signaling pathway.
• This study is the first to demonstrate Shionone’s therapeutic effect on DN.
• This study identified Sesn2 as a potential new target for DN treatment.
• The Sesn2-NRF2/HO-1 pathway may guide future drug development for diabetes.
INTRODUCTION
Diabetic nephropathy (DN) represents the most prevalent and severe complication associated with diabetes mellitus (DM) [1]. DN is characterized by glomerular fibrosis, resulting in the dysfunction of the filtration barrier, which is composed of glomerular endothelial cells (GEnCs), glomerular basement membrane (GBM), and kidney podocytes. Podocytes, serving as the primary components of the outermost layer of the glomerular filtration barrier, play a pivotal role in maintaining glomerular filtration function. Numerous studies have demonstrated that elevated glucose levels can induce epithelial-mesenchymal transition (EMT) in podocytes [2,3]. When podocytes begin to EMT, the integrity of glomerular capillary is compromised. Many inflammatory mediators, cytokines and transcriptional factors could infiltrate interior of filtration barrier and lead to hyperplasia of GBM.
Sestrins (SESNs) are conserved proteins inducible by environmental stress, which play a protective role against the accumulation of reactive oxygen species and inflammation in cells [4,5]. SESN2 can recruit sequestosome 1 (SQSTM1) and kelch like ECH associated protein 1 (Keap1) to mitochondrial autophagosomes for degradation [6]. The degradation of Keap1 can lead to reduced ubiquitination of nuclear factor erythroid 2-related factor 2 (NRF2), thus relieving it from its resting state in the cytoplasm [7]. Furthermore, NRF2 can inhibit NLR family pyrin domain containing 3 (NLRP3) via heme oxygenase-1 (HO-1) in rats with streptozotocin (STZ)-induced type 1 DM [8]. Recent findings have also demonstrated that SESN2 can suppress NLRP3 activation through mitophagy in macrophages [9]. Collectively, we hypothesize that SESN2 functions as an NLRP3 suppressor in DN. Consequently, compounds that upregulate the expression of SESN2 could potentially serve as effective therapeutics for the treatment of DN.
Aster of the Asteraceae family is a traditional Chinese herbal medicine which is mainly used as antitussive and expectorant drug in clinic [10,11]. Aster also has excellent antioxidant and anti-tumor effects [12]. Shionone (SH) is a triterpenoid compound extracted from the root of Aster, which is important for Aster to play specific pharmacological effects [13]. Previous research has found that SH could alleviates NLRP3-related inflammasome [14], but the underlying mechanism is still unclear. More research reveals that extraction from Aster could inhibit adipogenesis via adenosine monophosphate-activated protein kinase (AMPK) signaling pathway [15]. However, SESN2 has been shown to be an upstream activator of AMPK [16,17]. Therefore, we infer that SH, the main component of Aster, may activate the AMPK signaling pathway by up-regulating SESN2, which means SH may activate SESN2 directly. In this study, we hypothesize that SH may ameliorate DM through modulation of the SESN2-NRNF2/HO-1 signaling pathway. This modulation may alleviate NLRP3-associated inflammatory and fibrotic processes within the glomeruli, preserving kidney podocytes and maintaining the integrity of the glomerular filtration barrier.
METHODS
Reagents
STZ was obtained from Sigma-Aldrich (St. Louis, MO, USA). The blood glucose meter and blood glucose test strips were obtained from Roche (Basel, Switzerland). The urea assay kit and urine protein test kit were obtained from Nanjing JianCheng Bioengineering Institute (Nanjing, China). Interleukin-1β (IL-1β) enzyme-linked immunosorbent assay (ELISA) kit was obtained from Beyotime Biotechnology (Nanjing, China). SH was obtained from MedChemExpress (Monmouth Junction, NJ, USA).
Animal experiments
Fifty male C57BL/6 mice, weighing between 18 and 22 g, were purchased from the Zhejiang Experimental Animal Center and randomly allocated into five groups: (1) control (n=10), (2) type 2 diabetes mellitus (T2DM; n=10), (3) T2DM+SH (25 mg/kg/day, n=10), (4) T2DM+SH (50 mg/kg/day, n=10), and (5) T2DM+irbesartan (Irb) (50 mg/kg/day, n=10).
All subsequent experimental procedures were conducted in strict accordance with the Guide for Care and Use of Laboratory Animals issued by the Chinese National Institutes of Health. The experimental protocol was reviewed and approved by Institutional Animal Care and Use committee of China Pharmaceutical University. The approved number of animal experiments was 2022-05-16. All experiments were approved by the China Pharmaceutical University Ethics Committee.
Prior to the commencement of experiments, the mice were allowed to acclimate for a period of 1 week. The mice in the diabetes group were fed with TP 23400, 60% high-fat diet for diet-induced obesity (14.1% protein, 25.9% carbohydrate, 60% fat; TROPHIC Animal Feed High-tech Co. Ltd, Nantong, China). After 4 weeks, the mice in model groups were injected with STZ (intraperitoneal). The STZ was dissolved in a citrate buffer solution (pH 4.4) to achieve a concentration of 55 mg/kg. Upon administering STZ for a period of 1 week, a blood glucose level of ≥16.7 mmol/L was deemed as a successful induction of the T2DM model. At the conclusion of the experiment, the blood glucose levels, serum urea nitrogen, urine protein, and serum IL-1β were evaluated in the mice. Following the completion of these assessments, all mice were euthanized, and their kidneys were collected. Most of the tissues were fixed in formalin, embedded in paraffin, and sectioned for Masson staining, periodic acid–Schiff (PAS) staining, immunohistochemical assays, and transmission electron microscopy (TEM) scanning. The remaining tissue samples were stored at –80°C for subsequent Western blot analysis. The SESN2-/- C57BL/6 mice, weighing between 18 and 22 g, were obtained from Cyagen Biosciences (Santa Clara, CA, USA), and randomly divided into four groups: (1) SESN2+/+ (n=10), (2) SESN2-/- (n=10), (3) SESN2-/-+T2DM (n=10), and (4) SESN2-/-+T2DM+SH (50 mg/kg/day). The knockout mice underwent similar modeling and testing procedures as the wildtype C57BL/6 mice.
Immunohistochemistry
For immunohistochemistry assays, the kidney sections were dewaxed, and antigen retrieval was performed in citric acid buffer (pH 6.0). Then, the sections were processed according to the instructions of the KeyGen Biotech One-Step IHC Assay kit (Nanjing, China). The sections were incubated with SESN2, α-smooth muscle actin (α-SMA), NLPR3, and phosphorylated AMPK (P-AMPK) antibodies obtained from Santa Cruz Biotechnology (Dallas, TX, USA) at a dilution of 1:200.
Transmission electron microscopy
Kidneys were immersed in fresh 2.5% glutaraldehyde solution at 4°C for 2 hours, followed by dehydration, embedding, and slicing. These processes were conducted prior to observing the ultrastructure of podocytes using TEM. This experiment was carried out at the electron microscopy laboratory of Zhongda Hospital, Southeast University in Nanjing, China.
Cell culture
The immortalized mouse podocyte cell line, mouse podocyte clone 5 (MPC-5), generously donated by Professor Huiqin Xu from Nanjing University of Chinese Medicine in China, was cultured in Dulbecco’s Modified Eagle’s Medium enriched with 10% fetal bovine serum and 1% penicillin/streptomycin. This was maintained in a humidified incubator at 33°C with a 5% CO2 atmosphere. For the subsequent research, MPC-5 cells were exposed to high glucose (30 mM) for a duration of 48 hours.
Western blot assay
Total protein was extracted from cultured cells or kidney tissues using ice-cold radioimmunoprecipitation assay (RIPA) buffer supplemented with 1 mM phenylmethanesulfonyl fluoride (PMSF). Subsequently, 50 μg of protein extracts were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and electroblotted onto nitrocellulose membranes. After blocking with 5% nonfat milk in Tris buffered saline with Tween-20 for 1.5 hours, the membranes were incubated overnight at 4°C with antibodies against SESN2, NLPR3, IL-1β, α-SMA, P-AMPK, AMPK, NRF2, and HO-1, all obtained from Proteintech (Chicago, IL, USA), and β-actin antibody purchased from Abways Technology (Beijing, China). Subsequently, the membranes were washed and incubated with secondary antibodies (obtained from Abcam, Cambridge, UK) for 1 hour at room temperature (25°C). The bands were visualized using an enhanced chemiluminescent plus reagent kit purchased from Vazyme (Nanjing, China). Then, the visible images were quantified using ImageJ Software (National Institutes of Health, Bethesda, MD, USA).
SiRNA transfection
Before transfection, 1×106 MPC-5 cells were seeded into 6-well plates. Twenty-four hours later, the cells were transfected with Sesn2 siRNA (m) obtained from Santa Cruz Biotechnology, adhering to the specified protocol.
Quantitative-polymerase chain reaction
Kinney tissues from mice or MPC-5 cells were extracted to isolated RNA using Trizol following the instructions from the manufacturer. Then RNA was dissolved in diethylpyrocarbonate-treated water. The RNA solution was tested with a spectrophotometer (Nano 1000, Thermo Fisher Scientific, Waltham, MA, USA) by absorbance at 260 nm. The reverse transcription of total RNA was experimented by HiScript reverse transcriptase kit (Vazyme, Nanjing, China), then the reverse transcriptase-polymerase chain reaction (PCR) was activated on ABI 7500 (Applied Biosystems, Foster City, CA, USA) with Hieff quantitative-PCR (qPCR) SYBR Green Master Mix. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a control for target gene. The sequences of primers were listed in Table 1.
Statistical analysis
The results are presented as the mean±standard error of the mean. Data of multigroup comparisons were analyzed by t-test (two groups) in SPSS version 19.0 software (IBM Co., Armonk, NY, USA). Data were plotted using GraphPad Prism 5 software (GraphPad Software Inc., San Diego, CA, USA). A P value less than 0.05 was accepted as statistically significant.
RESULTS
Shionone improve weight change and kidney injury in STZ induced diabetic mice
Once the DM model was stabilized, the mice were divided into treatment groups. Irb was chosen as the positive drug control. Following the administration of SH and Irb, blood and urine samples were collected, along with the right kidney from each mouse. These samples were then used to calculate the kidney index and for tissue analysis. The results revealed that the kidneys of the model group exhibited enlarged size and increased body weight. However, with the administration of SH, this upward trend was effectively suppressed (Fig. 1A). Furthermore, the biochemical indices of the SH-treated mice demonstrated significant improvement, including blood urea nitrogen, random blood glucose, urine protein, urine albumin excretion, and serum IL-1β levels (Fig. 1B-G). These findings suggest that SH effectively ameliorates pathological changes in DM mice, with a superior effect compared to Irb.
Shionone improved the glomerular fibrosis of kidney in diabetic mice
To assess the feasibility of SH as a potential therapeutic agent for DN, we examined kidney sections from various experimental groups. Both Masson’s trichrome staining and PAS staining demonstrated a reduction in glomerular fibrosis in the SH-treated mice compared to the control groups (Fig. 2A-D). Detailed electron microscopy examination demonstrated a reduction in the thickening of the GBM in SH-treated mice with DM compared to controls (Fig. 2E). Given that inflammation is a key factor contributing to glomerular fibrosis in DM patients, as reported by previous studies [18], we hypothesize that the anti-fibrotic effect exhibited by SH is closely linked to its anti-inflammatory properties. We conducted additional analyses to assess the expression of fibrosis marker α-SMA and inflammatory markers NLPR3, IL-1β, and P-AMPK in kidney sections and tissues. The results unambiguously demonstrated that SH effectively suppressed inflammation and fibrosis in the glomeruli of DM mice (Fig. 2F-H). These findings suggest that the protective and ameliorative effects of SH on diabetic glomeruli primarily rely on its potent anti-inflammatory action, surpassing the efficacy of Irb in this regard.
Shionone induced SESN2-NRF2/HO-1 signaling pathway in DM mice
Previous research on the role of SH in interstitial cystitis injury has demonstrated its ability to decrease NLRP3 expression [14]. Furthermore, our investigation revealed that SESN2 can also attenuate NLRP3 expression through the NRF2/HO-1 signaling pathway [19]. Considering the findings, we hypothesized that the mechanism underlying SH’s action in DM mice might involve the activation of the SESN2-NRF2/HO-1 pathway. To validate this hypothesis, we conducted a detailed analysis of kidney sections and tissue proteins. The results of our investigation revealed an elevation in the expression levels of SESN2, NRF2, and HO-1 in mice treated with SH (Fig. 3A-C). Immunofluorescence histochemical triple staining, examined using confocal microscopy, further revealed that NRF2 in the kidneys of SH-treated DM mice exhibited increased abundance and translocation into the nucleus. This observation indicated the activation of NRF2 and its downstream pathway (Fig. 3D-F). However, the same degree of improvement was not observed in mice treated with Irb.
Shionone induced NLPR3 inhibition was SESN2 dependent
To delve deeper into the protective mechanism of SH on glomerulus, we conducted pharmacodynamic experiments utilizing SESN2 knockout mice. Masson’s trichrome staining and PAS staining revealed that the improvement observed with SH treatment in glomerulus was abrogated in SESN2-/- mice, indicating that the absence of SESN2 prevented the therapeutic benefits of SH, leading to persistent fibrosis in the kidney (Fig. 4A-D). The results from electron microscope scans mirrored the findings in SESN2-/- mice, with SH-treated mice failing to show any improvement in basement membrane thickening (Fig. 4E). Immunohistochemical staining and Western blotting analysis of kidney tissue further confirmed the absence of SH’s anti-inflammatory and anti-fibrotic effects in SESN2-/- mice (Fig. 4F-H). Confocal imaging of SH-treated SESN2-/- mice demonstrated the absence of NRF2 nuclear translocation (Fig. 4I-L). Collectively, these findings suggest that SH’s NLRP3 inhibitory effect is SESN2-dependent, highlighting SESN2 as a crucial target for SH in the treatment of DN.
Shionone inhibited NLRP3 via SESN2-NRF2/HO-1 signaling pathway in high glucose treated MPC-5 cells
Beyond the in vivo studies, we validated our observations using a cellular model. Specifically, we employed mouse podocyte cells treated with high glucose (30 mM) to mimic the in vitro conditions of DM. For positive control, we utilized Irb (1 μM). Following a 48-hour exposure to high glucose (30 mG), the expression levels of SESN2 and P-AMPK were notably decreased, whereas the expression of NLRP3 and α-SMA was significantly upregulated. In SH-treated MPC-5 cells, SESN2 expression was upregulated, leading to the activation of the downstream NRF2/HO-1 pathway. Concurrently, the expression of NLRP3 and α-SMA was suppressed. Notably, SH demonstrated more pronounced improvements compared to Irb. However, when SESN2 was knocked out using siRNA, all the positive effects induced by SH were abrogated. These findings suggest that the anti-inflammatory and anti-fibrotic effects of SH in T2DM mice are SESN2-dependent. Specifically, SH can upregulate SESN2, which in turn activates NRF2 nuclear translocation, ultimately inhibiting the expression of NLRP3 (Fig. 5).
DISCUSSION
DN, a complex kidney disease triggered by diabetes, predominantly manifests with renal inflammation and fibrosis, although its mechanism of occurrence and progression remains elusive [20,21]. Traditional Chinese medicine boasts a rich history in diabetes therapy, encompassing hundreds of diverse bioactive compounds that offer multiple preventive and protective effects on kidney diseases. In this study, we discovered the remarkable therapeutic potential of SH, a compound derived from the root of Aster, in treating DN.
To elucidate SH therapeutic effects, we evaluated its efficacy both in vitro and in vivo. Animal experimental data revealed a significant improvement in renal biochemical markers of model mice treated with SH, with a notable reduction in urine protein levels and urine albumin excretion. Upon further examination of the glomeruli, we observed that SH effectively alleviated fibrotic alterations. Notably, the fibrotic marker α-SMA and the inflammatory marker NLRP3 exhibited significant reductions in the glomeruli of DM mice. These findings suggest that SH can effectively ameliorate kidney filtration function in DM mice. Podocytes are epithelial cells attached to the outside of the GBM, which is responsible for filtering blood and removing waste products. Their injury can lead to the leakage of protein into the urine, further exacerbating kidney damage with inflammation and fibrosis, which is the primary cause of the pathological process of DN [22]. Therefore, we hypothesize that SH may exert its therapeutic effects on DN by protecting podocytes.
SESN2 is a promising therapeutic target for the treatment of DN due to its critical role in maintaining intracellular homeostasis in podocytes. SESN2 has been implicated in numerous mechanisms that respond to diverse stimuli, such as endoplasmic reticulum (ER) stress, inflammation, and mitophagy [16,23,24]. Further studies have unveiled that albumin suppresses SENS2 expression in renal tubular epithelial cells, thereby triggering EMT and ER stress [25-27]. These findings highlight the intricate relationship between albumin, SENS2, and cellular processes associated with glomeruli health and disease.
Our study found that SH had significant protective effects through SESN2-NRF2/HO-1 signaling pathway to inhibit inflammatory and fibrosis in DM mice. We noticed a notable presence of NLRP3-linked inflammatory and fibrotic responses in DM mice. However, interestingly, these inflammatory and fibrotic processes in the glomerulus were considerably suppressed in the DM mice treated with SH. The immunohistochemistry, TEM, and confocal microscopy results on kidney sections demonstrated that SH was capable of up-regulating SESN2 expression, facilitating NRF2 nuclear translocation, and activating the NRF2/HO-1 signaling pathway, leading to the suppression of NLRP3 expression. To further validate the therapeutic effect of SH on DN through SESN2, we conducted extensive verification of the pharmacological efficacy of SH using SESN2 knockout models (SESN2-/- mice and siRNA interference MPC-5 cells). The experimental results demonstrated that the previously observed activation of the NRF2/HO-1 signaling pathway by SH was significantly diminished or even eliminated.
In summary, our research has identified a novel compound, SH, which exhibits inhibitory effects on NLRP3-related inflammation and fibrosis, thereby safeguarding glomerular podocytes via the NRF2/HO-1 signaling pathway.
NOTES
CONFLICTS OF INTEREST
No potential conflict of interest relevant to this article was reported.
AUTHOR CONTRIBUTIONS
Conception or design: C.Q.
Acquisition, analysis, or interpretation of data: T.X., H.Z., Y.W.
Drafting the work or revising: M.C., C.W.
Final approval of the manuscript: all authors.
FUNDING
This project was supported by the National Science Foundation for Young Scientists of China (Grant No. 81803565) and Basic Foundation for China Pharmaceutical Universities (Grant No. 2632021ZD17).
Acknowledgements
None
Fig. 1.
Shionone (SH) improved weight change and the function of kidney in diabetic mice. Four weeks after streptozotocin injection, diabetic models were examined based on general indicators. (A) Body weight of each group of mice. (B) Kidney index of each group of mice, (C) blood urea nitrogen (BUN), (D) random blood glucose (RBG), (E) urine protein, (F) urine albumin, and (G) serum interleukin 1β (IL-1β) were tested following the instructions of the kits. Data are expressed as the mean±standard error of the mean. aP<0.05, bP<0.01, cP<0.001, compared with the control group; dP<0.01, eP<0.001, compared with the type 2 diabetes mellitus (T2DM) group; fP<0.05, gP<0.01, compared with the irbesartan group.
Fig. 2.
Shionone (SH) improved glomerulus fibrosis and inflammatory in diabetic mice.
(A) The histopathology analysis of glomeruli using Masson staining, ×200. (B) Quantitative analysis of Masson staining. (C) The histopathology analysis of glomeruli using Periodic acid–Schiff (PAS) staining, ×200. (D) Quantitative analysis of PAS staining. (E) Subcellular structure analysis of podocytes detected by transmission electron microscopy, ×10,000. (F) Expression of α-smooth muscle actin (α-SMA), NLR family pyrin domain containing 3 (NLRP3), interleukin 1β (IL-1β), phosphorylated adenosine monophosphate-activated protein kinase (P-AMPK) in glomeruli through immunohistochemistry, ×200. (G) α-SMA, NLRP3, IL-1β, P-AMPK proteins from wild-type mice detected by Western blot. (H) Quantitative analysis of Western blot. Data are expressed as the mean±standard error of the mean. aP<0.05, bP<0.01, cP<0.001, compared with the control group; dP<0.05, eP<0.01, fP<0.001 compared with the type 2 diabetes mellitus (T2DM) group; gP<0.05, compared with the irbesartan group.
Fig. 3.
Shionone (SH) activated nuclear factor erythroid 2-related factor 2 (NRF2)/heme oxygenase-1 (HO-1) via sestrin-2 (SESN2) in diabetic mice. (A) Expression of SESN2 in glomeruli through immunohistochemistry, ×200. (B) SESN2, NRF2, HO-1 proteins from wild-type mice detected by Western blot. (C) Quantitative analysis of Western blot. (D) Effect of SH on the nucleus expression of NRF2 in type 2 diabetes mellitus (T2DM) mice kidney was detected by Western blot. (E) Effect of SH on the mRNA level of SESN2, NRF2 in T2DM mice. (F) SESN2, NRF2 in detected by confocal scanning microscopy, ×200, ×500. The position indicated by the white arrows is the site of nuclear import of NRF2. Data are expressed as the mean±standard error of the mean. DAPI, 4′,6-diamidino-2-phenylindole. aP<0.05, bP<0.01, compared with the control group; cP<0.01, dP<0.001 compared with the T2DM group; eP<0.001, compared with the irbesartan group.
Fig. 4.
Shionone (SH)’s anti-fibrosis effect was sestrin-2 (SESN2) dependent in diabetic mice.
(A) The histopathology analysis of SESN2-/- glomeruli using Masson staining, ×200. (B) Quantitative analysis of Masson staining. (C) The histopathology analysis of SESN2-/- glomeruli using Periodic acid–Schiff (PAS) staining, ×200. (D) Quantitative analysis of PAS staining. (E) Subcellular structure analysis of podocytes in SESN2-/- mice detected by transmission electron microscopy, ×10,000. (F) Expression of SESN2, phosphorylated adenosine monophosphate-activated protein kinase (PAMPK), NLR family pyrin domain containing 3 (NLRP3), interleukin 1β (IL-1β), α-smooth muscle actin (α-SMA) in SESN2-/- glomeruli through immunohistochemistry, ×200. (G) P-AMPK, NLRP3, IL-1β, α-SMA proteins from SESN2-/- mice detected by Western blot. (H) Quantitative analysis of Western blot. (I) SESN2, nuclear factor erythroid 2-related factor 2 (NRF2), heme oxygenase- 1 (HO-1) proteins from SESN2-/- mice detected by Western blot. (J) Effect of SH on the nucleus expression of NRF2 in type 2 diabetes mellitus (T2DM) SESN2-/- mice kidney was detected by Western blot. (K) Quantitative analysis of Western blot. (L) SESN2, NRF2 in detected by confocal scanning microscopy in SESN2-/- mice, ×200, ×500. The position indicated by the white arrows is the site of nuclear import of NRF2. Data are expressed as the mean±standard error of the mean. DAPI, 4´,6-diamidino-2-phenylindole. aP<0.05, bP<0.01, cP<0.001, compared with the control group; dP<0.05, eP<0.01, fP<0.001 compared with the SESN2-/- group.
Fig. 5.
Shionone (SH) could inhibit NLR family pyrin domain containing 3 (NLRP3) via sestrin-2 (SESN2)-nuclear factor erythroid 2-related factor 2 (NRF2)/heme oxygenase-1 (HO-1) in high glucose (HG) treated mouse podocyte clone 5 (MPC-5) cells. (A) Expression of SESN2, phosphorylated adenosine monophosphate-activated protein kinase (P-AMPK), NRF2, HO-1, NLRP3, interleukin 1β (IL-1β), α-smooth muscle actin (α-SMA) in MPC-5 cells detected by Western blot. (B) Quantitative analysis of Western blot. (C) Effect of SH on the mRNA level of SESN2, NRF2, NLRP3, α-SMA in MPC-5 cells. Quantitative analysis of Western blot. Data are expressed as the mean±standard error of the mean. aP<0.05, bP<0.01, cP<0.001, compared with the control group; dP<0.05, eP<0.01, fP<0.001 compared with the SESN2-/- group; gP<0.05, hP<0.01, iP<0.001 compared with the SESN2+/+ group.
Table 1.
Mice primers used in quantitative-polymerase chain reaction
1. Lou J, Jing L, Yang H, Qin F, Long W, Shi R. Risk factors for diabetic nephropathy complications in community patients with type 2 diabetes mellitus in Shanghai: logistic regression and classification tree model analysis. Int J Health Plann Manage 2019;34:1013-24.ArticlePubMedPDF
2. Ma Y, Chen Y, Xu H, Du N. The influence of angiopoietin-like protein 3 on macrophages polarization and its effect on the podocyte EMT in diabetic nephropathy. Front Immunol 2023;14:1228399.ArticlePubMedPMC
3. Ying Q, Wu G. Molecular mechanisms involved in podocyte EMT and concomitant diabetic kidney diseases: an update. Ren Fail 2017;39:474-83.ArticlePubMedPMCPDF
4. Hsieh YH, Chao AC, Lin YC, Chen SD, Yang DI. The p53/NF-kappaB-dependent induction of sestrin2 by amyloid-beta peptides exerts antioxidative actions in neurons. Free Radic Biol Med 2021;169:36-61.ArticlePubMed
5. Liu Y, Li M, Du X, Huang Z, Quan N. Sestrin 2, a potential star of antioxidant stress in cardiovascular diseases. Free Radic Biol Med 2021;163:56-68.ArticlePubMed
6. Lee DH, Park JS, Lee YS, Han J, Lee DK, Kwon SW, et al. SQST M1/p62 activates NFE2L2/NRF2 via ULK1-mediated autophagic KEAP1 degradation and protects mouse liver from lipotoxicity. Autophagy 2020;16:1949-73.ArticlePubMedPMC
7. Liao K, Su X, Lei K, Liu Z, Lu L, Wu Q, et al. Sinomenine protects bone from destruction to ameliorate arthritis via activating p62Thr269/Ser272-Keap1-Nrf2 feedback loop. Biomed Pharmacother 2021;135:111195.ArticlePubMed
8. Gao Y, Li J, Chu S, Zhang Z, Chen N, Li L, et al. Ginsenoside Rg1 protects mice against streptozotocin-induced type 1 diabetic by modulating the NLRP3 and Keap1/Nrf2/HO-1 pathways. Eur J Pharmacol 2020;866:172801.ArticlePubMed
9. Kim MJ, Bae SH, Ryu JC, Kwon Y, Oh JH, Kwon J, et al. SESN2/sestrin2 suppresses sepsis by inducing mitophagy and inhibiting NLRP3 activation in macrophages. Autophagy 2016;12:1272-91.ArticlePubMedPMC
10. Ngabire D, Seong YA, Patil MP, Niyonizigiye I, Seo YB, Kim GD. Anti-inflammatory effects of Aster incisus through the inhibition of NF-κB, MAPK, and Akt pathways in LPS-stimulated RAW 264.7 macrophages. Mediators Inflamm 2018;2018:4675204.ArticlePubMedPMCPDF
11. Choi JH, Chung KS, Jin BR, Cheon SY, Nugroho A, Roh SS, et al. Anti-inflammatory effects of an ethanol extract of Aster glehni via inhibition of NF-κB activation in mice with DSS-induced colitis. Food Funct 2017;8:2611-20.ArticlePubMed
12. Seo S, Kim K. Antioxidant activities of Aster glehni extracted with different solvents. Iran J Public Health 2019;48:176-8.ArticlePubMedPMCPDF
13. Sawai S, Uchiyama H, Mizuno S, Aoki T, Akashi T, Ayabe S, et al. Molecular characterization of an oxidosqualene cyclase that yields shionone, a unique tetracyclic triterpene ketone of Aster tataricus. FEBS Lett 2011;585:1031-6.ArticlePubMedPDF
14. Wang X, Yin H, Fan L, Zhou Y, Tang X, Fei X, et al. Shionone alleviates NLRP3 inflammasome mediated pyroptosis in interstitial cystitis injury. Int Immunopharmacol 2021;90:107132.ArticlePubMed
15. Han MH, Jeong JS, Jeong JW, Choi SH, Kim SO, Hong SH, et al. Ethanol extracts of Aster yomena (Kitam.) Honda inhibit adipogenesis through the activation of the AMPK signaling pathway in 3T3-L1 preadipocytes. Drug Discov Ther 2017;11:281-7.PubMed
16. Pan C, Ai C, Liang L, Zhang B, Li Q, Pu L, et al. Sestrin2 protects against hypoxic nerve injury by regulating mitophagy through SESN2/AMPK pathway. Front Mol Biosci 2023;10:1266243.ArticlePubMedPMC
17. Bodmer D, Levano-Huaman S. Sesn2/AMPK/mTOR signaling mediates balance between survival and apoptosis in sensory hair cells under stress. Cell Death Dis 2017;8:e3068.ArticlePubMedPMCPDF
18. Aravindhan V, Bobhate A, Sathishkumar K, Viswanathan V. Serum levels of novel anti-inflammatory cytokine interleukin-38 in diabetes patients infected with latent tuberculosis (DM-LTB-3). J Diabetes Complications 2022;36:108133.ArticlePubMed
19. Ding X, Zhao H, Qiao C. Icariin protects podocytes from NLRP3 activation by Sesn2-induced mitophagy through the Keap1-Nrf2/HO-1 axis in diabetic nephropathy. Phytomedicine 2022;99:154005.ArticlePubMed
20. Hanna RM, Yanny B, Arman F, Barsoum M, Mikhail M, Al Baghdadi M, et al. Everolimus worsening chronic proteinuria in patient with diabetic nephropathy post liver transplantation. Saudi J Kidney Dis Transpl 2019;30:989-94.ArticlePubMed
21. Li WH, Yin YM, Chen H, Rui ZR, Yuan Y, Yun H, et al. Clinical research on individualized hemodialysis preventing unconventional hypotension in diabetic nephropathy patient. Int J Artif Organs 2020;43:229-33.ArticlePubMedPDF
22. Zhang L, Wen Z, Han L, Zheng Y, Wei Y, Wang X, et al. Research progress on the pathological mechanisms of podocytes in diabetic nephropathy. J Diabetes Res 2020;2020:7504798.ArticlePubMedPMCPDF
23. Park HJ, Yang SG, Koo DB. SESN2/NRF2 signaling activates as a direct downstream regulator of the PERK pathway against endoplasmic reticulum stress to improve the in vitro maturation of porcine oocytes. Free Radic Biol Med 2022;178:413-27.ArticlePubMed
24. Feng L, Li B, Cai M, Zhang Z, Zhao Y, Yong SS, et al. Resistance exercise alleviates the prefrontal lobe injury and dysfunction by activating SESN2/AMPK/PGC-1α signaling pathway and inhibiting oxidative stress and inflammation in mice with myocardial infarction. Exp Neurol 2023;370:114559.ArticlePubMed
25. Jia Y, Zheng Z, Yang Y, Zou M, Li J, Wang L, et al. MiR-4756 promotes albumin-induced renal tubular epithelial cell epithelial-to-mesenchymal transition and endoplasmic reticulum stress via targeting Sestrin2. J Cell Physiol 2019;234:2905-15.ArticlePubMedPDF
26. Lee S, Shin J, Hong Y, Shin SM, Shin HW, Shin J, et al. Sestrin2 alleviates palmitate-induced endoplasmic reticulum stress, apoptosis, and defective invasion of human trophoblast cells. Am J Reprod Immunol 2020;83:e13222.ArticlePubMedPDF
27. Watany MM, El-Horany HE, Elhosary MM, Elhadidy AA. Clinical application of RUBCN/SESN2 mediated inhibition of autophagy as biomarkers of diabetic kidney disease. Mol Med 2022;28:147.ArticlePubMedPMCPDF
Figure & Data
References
Citations
Citations to this article as recorded by
Shionone attenuates endoplasmic reticulum stress-associated ferroptosis in cardiomyocytes by reducing LCN2 and regulating PI3K/Akt signaling Chunni Gao, Xingjuan Gao, Jinshuang Li Journal of Bioenergetics and Biomembranes.2026;[Epub] CrossRef
Perillaldehyde inhibits oxidative stress, NLRP3-mediated inflammation and fibrosis in diabetic nephropathy through regulating HMOX1 Wen Hao, Chunhua Liu, Jing Feng, Zhanliang Ren Hereditas.2026;[Epub] CrossRef
Facile Formulation of a Resveratrol-Mediated Multibond Network Hydrogel with Efficient Sustainable Antibacterial, Reactive Oxygen Species Scavenging, Pro-Angiogenesis, and Immunomodulation Activities for Accelerating Infected Wound Healing Jing Feng, Zifei Wang, Xiyu Li, Chongyun Bao, Yu Xiao ACS Applied Materials & Interfaces.2025; 17(4): 6144. CrossRef
Shionone Inhibits Glomerular Fibirosis by Suppressing NLRP3 Related Inflammasome though SESN2-NRF2/ HO-1 Pathway
Fig. 1. Shionone (SH) improved weight change and the function of kidney in diabetic mice. Four weeks after streptozotocin injection, diabetic models were examined based on general indicators. (A) Body weight of each group of mice. (B) Kidney index of each group of mice, (C) blood urea nitrogen (BUN), (D) random blood glucose (RBG), (E) urine protein, (F) urine albumin, and (G) serum interleukin 1β (IL-1β) were tested following the instructions of the kits. Data are expressed as the mean±standard error of the mean. aP<0.05, bP<0.01, cP<0.001, compared with the control group; dP<0.01, eP<0.001, compared with the type 2 diabetes mellitus (T2DM) group; fP<0.05, gP<0.01, compared with the irbesartan group.
Fig. 2. Shionone (SH) improved glomerulus fibrosis and inflammatory in diabetic mice.
(A) The histopathology analysis of glomeruli using Masson staining, ×200. (B) Quantitative analysis of Masson staining. (C) The histopathology analysis of glomeruli using Periodic acid–Schiff (PAS) staining, ×200. (D) Quantitative analysis of PAS staining. (E) Subcellular structure analysis of podocytes detected by transmission electron microscopy, ×10,000. (F) Expression of α-smooth muscle actin (α-SMA), NLR family pyrin domain containing 3 (NLRP3), interleukin 1β (IL-1β), phosphorylated adenosine monophosphate-activated protein kinase (P-AMPK) in glomeruli through immunohistochemistry, ×200. (G) α-SMA, NLRP3, IL-1β, P-AMPK proteins from wild-type mice detected by Western blot. (H) Quantitative analysis of Western blot. Data are expressed as the mean±standard error of the mean. aP<0.05, bP<0.01, cP<0.001, compared with the control group; dP<0.05, eP<0.01, fP<0.001 compared with the type 2 diabetes mellitus (T2DM) group; gP<0.05, compared with the irbesartan group.
Fig. 3. Shionone (SH) activated nuclear factor erythroid 2-related factor 2 (NRF2)/heme oxygenase-1 (HO-1) via sestrin-2 (SESN2) in diabetic mice. (A) Expression of SESN2 in glomeruli through immunohistochemistry, ×200. (B) SESN2, NRF2, HO-1 proteins from wild-type mice detected by Western blot. (C) Quantitative analysis of Western blot. (D) Effect of SH on the nucleus expression of NRF2 in type 2 diabetes mellitus (T2DM) mice kidney was detected by Western blot. (E) Effect of SH on the mRNA level of SESN2, NRF2 in T2DM mice. (F) SESN2, NRF2 in detected by confocal scanning microscopy, ×200, ×500. The position indicated by the white arrows is the site of nuclear import of NRF2. Data are expressed as the mean±standard error of the mean. DAPI, 4′,6-diamidino-2-phenylindole. aP<0.05, bP<0.01, compared with the control group; cP<0.01, dP<0.001 compared with the T2DM group; eP<0.001, compared with the irbesartan group.
Fig. 4. Shionone (SH)’s anti-fibrosis effect was sestrin-2 (SESN2) dependent in diabetic mice.
(A) The histopathology analysis of SESN2-/- glomeruli using Masson staining, ×200. (B) Quantitative analysis of Masson staining. (C) The histopathology analysis of SESN2-/- glomeruli using Periodic acid–Schiff (PAS) staining, ×200. (D) Quantitative analysis of PAS staining. (E) Subcellular structure analysis of podocytes in SESN2-/- mice detected by transmission electron microscopy, ×10,000. (F) Expression of SESN2, phosphorylated adenosine monophosphate-activated protein kinase (PAMPK), NLR family pyrin domain containing 3 (NLRP3), interleukin 1β (IL-1β), α-smooth muscle actin (α-SMA) in SESN2-/- glomeruli through immunohistochemistry, ×200. (G) P-AMPK, NLRP3, IL-1β, α-SMA proteins from SESN2-/- mice detected by Western blot. (H) Quantitative analysis of Western blot. (I) SESN2, nuclear factor erythroid 2-related factor 2 (NRF2), heme oxygenase- 1 (HO-1) proteins from SESN2-/- mice detected by Western blot. (J) Effect of SH on the nucleus expression of NRF2 in type 2 diabetes mellitus (T2DM) SESN2-/- mice kidney was detected by Western blot. (K) Quantitative analysis of Western blot. (L) SESN2, NRF2 in detected by confocal scanning microscopy in SESN2-/- mice, ×200, ×500. The position indicated by the white arrows is the site of nuclear import of NRF2. Data are expressed as the mean±standard error of the mean. DAPI, 4´,6-diamidino-2-phenylindole. aP<0.05, bP<0.01, cP<0.001, compared with the control group; dP<0.05, eP<0.01, fP<0.001 compared with the SESN2-/- group.
Fig. 5. Shionone (SH) could inhibit NLR family pyrin domain containing 3 (NLRP3) via sestrin-2 (SESN2)-nuclear factor erythroid 2-related factor 2 (NRF2)/heme oxygenase-1 (HO-1) in high glucose (HG) treated mouse podocyte clone 5 (MPC-5) cells. (A) Expression of SESN2, phosphorylated adenosine monophosphate-activated protein kinase (P-AMPK), NRF2, HO-1, NLRP3, interleukin 1β (IL-1β), α-smooth muscle actin (α-SMA) in MPC-5 cells detected by Western blot. (B) Quantitative analysis of Western blot. (C) Effect of SH on the mRNA level of SESN2, NRF2, NLRP3, α-SMA in MPC-5 cells. Quantitative analysis of Western blot. Data are expressed as the mean±standard error of the mean. aP<0.05, bP<0.01, cP<0.001, compared with the control group; dP<0.05, eP<0.01, fP<0.001 compared with the SESN2-/- group; gP<0.05, hP<0.01, iP<0.001 compared with the SESN2+/+ group.
Graphical abstract
Fig. 1.
Fig. 2.
Fig. 3.
Fig. 4.
Fig. 5.
Graphical abstract
Shionone Inhibits Glomerular Fibirosis by Suppressing NLRP3 Related Inflammasome though SESN2-NRF2/ HO-1 Pathway
Gene
Sequence (5’-3’)
GAPDH
Forward
AGGTCGGTGTGAACGGATTTG
Reverse
GGGGTCGTTGATGGCAACA
SESN2
Forward
GAGTGCCATTCCGAGATCAAG
Reverse
TAGTCCGGGTGTAGACCCATC
NRF2
Forward
TAGATGACCATGAGTCGCTTGC
Reverse
GCCAAACTTGCTCCATGTCC
NLRP3
Forward
ATTACCCGCCCGAGAAAGG
Reverse
CATGAGTGTGGCTAGATCCAAG
α-SMA
Forward
CCCAGACATCAGGGAGTAATGG
Reverse
TCTATCGGATACTTCAGCGTCA
Table 1. Mice primers used in quantitative-polymerase chain reaction
Xiao T, Zhao H, Wang Y, Chen M, Wang C, Qiao C. Shionone Inhibits Glomerular Fibirosis by Suppressing NLRP3 Related Inflammasome though SESN2-NRF2/ HO-1 Pathway. Diabetes Metab J. 2025;49(1):34-48.