Supplementary Fig. 1
Relative protein level of MondoA in various muscles. GAS, gastrocnemius; QF, quadriceps femoris; EDL, extensor digitorum longus; SOL, soleus. aP<0.05, bP<0.01, cP<0.001.
dmj-2019-0212-s001.pdf
Supplementary Fig. 2
(A) Quantitative real-time polymerase chain reaction analysis, (B) Western blotting analysis, and (C) relative protein level of MondoA in skeletal muscle from mice of different ages. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. aP<0.05, bP<0.01, cP<0.001.
dmj-2019-0212-s002.pdf
Supplementary Fig. 4
Expression levels of myogenic markers increased during differentiation. Relative mRNA levels of (A) myosin heavy chain (MyHC), (B) myogenin (MyoG), and (C) insulin growth factor 2 (IGF2) during culture in growth medium (GM) (−2, −1, and 0 day) and differentiation medium (DM) (2, 4, 6, and 8 days). aP<0.001.
dmj-2019-0212-s004.pdf
Supplementary Fig. 5
(A) Relative protein levels of MondoA, myosin heavy chain (MyHC), and myogenin (MyoG) in C2C12 cells transfected with small interfering RNA against MondoA (siMondoA) or negative control (NC) at 0, 2, and 6-day postdifferentiation. (B) Relative protein levels of key molecules in the phosphoinositide 3-kinase (PI3K)/Akt pathway in C2C12 cells transfected with siMondoA or NC at 0, 2, and 6-day postdifferentiation. (C) Relative protein levels of key molecules in the phosphatase and tensin homolog (PTEN)/PI3K/Akt pathway in C2C12 myoblasts transfected with siMondoA. GM, growth medium; DM, differentiation medium; d, day. aP<0.05, bP<0.01, cP<0.001.
dmj-2019-0212-s005.pdf
Fig. 1MondoA expression in various tissues and C2C12 cells. (A) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of MondoA expression in various tissues (n=5 mice per group). (B) qRT-PCR (top) and Western blotting (bottom) analyses of MondoA expression in various muscles. (C) qRT-PCR analysis of MondoA expression in C2C12 cells cultured in growth medium (GM) and differentiation medium (DM) (experiments were performed in triplicate). Data represent mean±standard error of the mean. GAS, gastrocnemius; QF, quadriceps femoris; EDL, extensor digitorum longus; SOL, soleus; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. aP<0.05, bP<0.001.
Fig. 2Muscle-specific MondoA knockout (MAKO) impairs myofiber size. (A) Morphology of gastrocnemius muscle (top) and quadriceps (bottom) from wild-type (WT) and MAKO mice. (B) Relative gastrocnemius muscle weight of WT and MAKO mice. (C) Representative fluorescent staining of myosin heavy chain (MyHC) type II fibers (green) and dystrophin (red) in gastrocnemius muscles. MyHC type I fibers are unstained (black) (n=5). Scale bar=100 µm. (D) Mean cross-sectional area (CSA; µm2) of type I and II diaphragm skeletal muscle myofibers. (E) Proportions (%) of muscle fiber types in entire cross-section of gastrocnemius muscle. CSA, cross-sectional area; DAPI, 4′,6-diamidino-2-phenylindole. aP<0.05, bP<0.001.
Fig. 3MondoA knockdown decreases C2C12 cell proliferation and migration. (A) Proliferation was analyzed by colony formation assay after 1.0×103 C2C12 myoblasts transfected with small interfering RNA against MondoA (siMondoA) or negative control (NC) were seeded and cultured for 7 days. (B) Proliferation was analyzed by microphotograph after transfection with siMondoA or NC for 72 hours. (C) Cell number was assessed after culture in growth medium for 12, 24, 36, and 72 hours after seeding 2.8×105 transfected C2C12 myoblasts. (D) Quantitative real-time polymerase chain reaction analysis of cyclinD1 and E2 in transfected C2C12 myoblasts. (E) Transwell assay of transfected C2C12 myoblasts (5×104 cells were seeded in the top chamber). Scale bar=100 µm. (F) Histogram showing the numbers of migrated myoblasts. aP<0.05, bP<0.01, cP<0.001.
Fig. 4
MondoA knockdown inhibited the myogenic differentiation of C2C12 myoblasts. (A) Microphotograph of C2C12 myoblasts, transfected with small interfering RNA (siRNA) against MondoA (siMondoA) or negative control (NC), at 6-day postdifferentiation. Scale bar=100 µm. (B) Immunostaining for myosin heavy chain (MyHC; red) and 4′,6-diamidino-2-phenylindole (DAPI) straining (blue) in C2C12 cells transfected with siMondoA or NC at 6-day postdifferentiation. The cells climbed to the carry sheet glass, were fixed with 4% paraformaldehyde, and were then stained with MyHC antibody (1:200). Scale bar=50 µm. (C) Fusion index of myotubes based on the ratio of the number of nuclei in MyHC-positive cells to the total number of nuclei (DAPI, blue), in at least five random microscopic fields. (D) Quantitative real-time polymerase chain reaction analysis of MondoA, MyHC, myogenin (MyoG), and insulin growth factor 2 (IGF2) at 6-day postdifferentiation in C2C12 cells transfected with siMondoA or NC. (E) Western blotting analysis of MondoA, MyHC, and MyoG at 0, 2, and 6-day postdifferentiation in C2C12 cells transfected with siMondoA or NC. (F) Western blotting analysis of key molecules in the phosphoinositide 3-kinase (PI3K)/Akt pathway at 0, 2, and 6-day postdifferentiation in C2C12 cells transfected with siMondoA or NC. (G) Proliferation was analyzed by microphotograph after transfection of cells with siMondoA and siRNA against phosphatase and tensin homolog (siPTEN) for 48 hours. −: siRNA against control. +: siPTEN. (H) Histogram showing the numbers of cells transfected with siMondoA and siPTEN for 48 hours. (I) Western blotting analysis of key molecules in the PTEN/PI3K/Akt pathway in C2C12 myoblasts transfected with siMondoA and siPTEN. GM, growth medium; DM, differentiation medium; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. aP<0.05, bP<0.01, cP<0.001.
"Updated on 30 September 2021"
Fig. 5MondoA knockdown increases muscle glycogen level by promoting glucose uptake of skeletal muscle cells. (A) Periodic acid-Schiff (PAS) staining of gastrocnemius sections from wild-type (WT) and MondoA knockout (MAKO) mice. Scale bar=100 µm (top) or 200 µm (bottom). (B) Muscle glycogen content of gastrocnemius muscle (80 mg per group) from WT and MAKO mice (n=5). (C) Quantitative real-time polymerase chain reaction analysis of MondoA, thioredoxin-interacting protein (TXNIP), and arrestin domain-containing 4 (ARRDC4) in gastrocnemius muscle from WT and MAKO mice. (D) Western blotting analysis of MondoA and TXNIP in gastrocnemius muscle from WT and MAKO mice. (E) Western blotting analysis of glucose transporter 1 (GLUT1) and GLUT4 in the cell membrane and cytoplasm in the gastrocnemius muscle from WT and MAKO mice. (F) Western blotting analysis of GLUT1 and GLUT4 in C2C12 myotubes after transfection of C2C12 cells with small interfering RNA against MondoA (siMondoA) or negative control (NC). (G) Glycogen content of C2C12 myotubes cultured in 10-cm dishes after transfection with siMondoA or NC. (H) Relative glucose uptake of C2C12 myotubes after transfection with siMondoA or NC. aP<0.05, bP<0.01, cP<0.001.
Table 1.Primers for quantitative real-time polymerase chain reaction
Primer |
Sequence (5´-3´) |
MondoA-F |
TGCTACCTGCCACAGGAGTC |
MondoA-R |
GACTCAAACAGTGGCTTGATGA |
MyHC-F |
CGAAGAGTAAGGCTGTCCCG |
MyHC-R |
GCGCATGACCAAAGGTTTCA |
MyoG-F |
CAGCCCAGCGAGGGAATTTA |
MyoG-R |
AGAAGCTCCTGAGTTTGCCC |
IGF2-F |
CAAACGTCATCGTCCCCTGA |
IGF2-R |
TGTGGGACGTGATGGAACTG |
TXNIP-F |
GTCTCAGCAGTGCAAACAGACTT |
TXNIP-R |
GCTCGAAGCCGAACTTGTACTC |
ARRDC4-F |
CAGCCTCCTCAGAAGTGGAAT |
ARRDC4-R |
TCAGACGGAAGCTGAAAGCG |
GLUT4-F |
CTGCAAAGCGTAGGTACCA |
GLUT4-R |
CCTCCCGCCCTTAGTTG |
CyclinD1-F |
GCGTACCCTGACACCAATCTC |
CyclinD1-R |
ACTTGAAGTAAGATACGGAGGGC |
CyclinE2-F |
ATGTCAAGACGCAGCCGTTTA |
CyclinE2-R |
GCTGATTCCTCCAGACAGTACA |
18srRNA-F |
TTGACTCAACACGGGAAACC |
18srRNA-R |
AGACAAATCGCTCCACCAAC |